• Users Online:290
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Search Ahead of print Current issue Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2016  |  Volume : 10  |  Issue : 1  |  Page : 42-51

Therapeutic evaluation of homoeopathic drug Crotalus horridus 200C against Ehrlichiosis-infected dogs in Mizoram


1 Department of Veterinary Medicine, College of Veterinary Sciences and Animal Husbandry, Central Agricultural University, Selesih, Aizawl, Mizoram, India
2 Department of Microbiology, College of Veterinary Sciences and Animal Husbandry, Central Agricultural University, Selesih, Aizawl, Mizoram, India
3 Department of Veterinary Parasitology, College of Veterinary Sciences and Animal Husbandry, Central Agricultural University, Selesih, Aizawl, Mizoram, India

Date of Submission27-Oct-2015
Date of Acceptance29-Feb-2016
Date of Web Publication21-Mar-2016

Correspondence Address:
Kalyan Sarma
Department of Veterinary Medicine, College of Veterinary Sciences and Animal Husbandry, Central Agricultural University, Selesih, Aizawl - 796 014, Mizora
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0974-7168.179150

Rights and Permissions
  Abstract 

Objective: To study, the effect of a homoeopathic medicine Crotalus horridus 200C on ehrlichiosis in dogs in an endemic area of Aizawl district of Mizoram state of India.
Materials and Methods: To evaluate the efficacy of Crotalus horridus 200C against ehrlichiosis dogs. 12 positive cases confirmed by polymerase chain reaction (PCR) were divided into two groups comprising six dogs in each group. One group was treated with standard therapy (doxycycline) and other group was treated with Crotalus horridus 200C at 4 pills orally for 20 days. Clinical improvement of affected dogs was recorded after therapy. Important haemato-biochemical parameters before and after therapy such as haemoglobin (Hb), packed cell volume (PCV), total erythrocyte count (TEC), total leukocyte count (TLC), differential leukocyte count (DLC), platelet count, total protein, albumin, globulin, A:G ratio, total bilirubin, serum creatinine, blood urea nitrogen (BUN), and liver-specific enzymes namely alanine aminotransferase (ALT) and alkaline phosphatase (ALP) were assessed following standard protocol. All the parameters were compared with a control healthy group (T3). All experiment dogs were from different age with different breeds and bloods were collected at forenoon only.
Results: PCR test yielded 13 dogs positive out of 67 suspected samples screened (19.40%) with an amplification of 387 bp fragment from 16S rRNA gene of E. Canis. Off total positive, only 8 (61.53%) could be detected in peripheral blood smear. Crotalus horridus-treated group of dogs showed clinical recovery from fever and temperature to normalcy by the 14th day posttreatment. Haemato-biochemical profiles of affected dogs such as Hb, PCV, TEC, TLC, DLC, platelet count, total protein, albumin, globulin, A:G ratio, total bilirubin, serum creatinine, BUN, and liver-specific enzymes namely ALT and ALP were turned to normalcy within 21 days of post-treatment.
Conclusion: Nested PCR assay had been shown to be sensitive and specific for detection of Ehrlichia canis. Crotalus horridus 200C may be an effective and choice of drug for control of canine ehrlichiosis.

Keywords: Crotalus horridus 200C, Ehrlichiosis, Haemato-biochemical changes, Homoeopathy, Veterinary medicine


How to cite this article:
Tungnunga IB, Sarma K, Roychoudhury P, Borthakur SK, Das G, Prasad H, Behera SK. Therapeutic evaluation of homoeopathic drug Crotalus horridus 200C against Ehrlichiosis-infected dogs in Mizoram. Indian J Res Homoeopathy 2016;10:42-51

How to cite this URL:
Tungnunga IB, Sarma K, Roychoudhury P, Borthakur SK, Das G, Prasad H, Behera SK. Therapeutic evaluation of homoeopathic drug Crotalus horridus 200C against Ehrlichiosis-infected dogs in Mizoram. Indian J Res Homoeopathy [serial online] 2016 [cited 2019 Sep 16];10:42-51. Available from: http://www.ijrh.org/text.asp?2016/10/1/42/179150


  Introduction Top


Canine ehrlichiosis is a tick-borne disease caused by Ehrlichia canis, also known as canine monocytic ehrlichiosis (CME), canine haemorrhagic fever, tracker dog disease, canine tick typhus, Nairobi bleeding disorder, and tropical canine pancytopenia.[1],[2] CME is currently reported throughout the world [3] but at higher frequencies in tropical and subtropical regions including Asia, Africa, Europe, America,[4],[5],[6] and India.[7],[8] The infection is manifested by fever, depression, dyspnea, anorexia, weight loss, limping as well as unwillingness to move due to arthritis, together with pains in musculoskeletal system.[8] Laboratory findings include thrombocytopenia, leukopenia, mild anaemia (normocytic and nonregenerative), and hypergammaglobulinemia. Serum biochemistry of the affected dogs reveals hypoproteinemia, hypoalbuminemia, hyperglobulinemia, increased activities of the alkaline phosphatase (ALP) and alanine aminotransferase (ALT) and the rise of the concentration of creatinine and urea.[9],[10]

Diagnosis of ehrlichiosis in dogs is based on the symptoms along with microscopic, haematological, biochemical, serological, and molecular examinations. In infected host, Ehrlichias are found in three forms in peripheral smears creating cytoplasmatic inclusion bodies – initial corpuscles, morulas; formed by aggregation of inclusion bodies and elementary corpuscles; created after the morula's disintegration.[11],[12] The most sensitive diagnostic method of ehrlichiosis is the polymerase chain reaction (PCR) technique.[13],[14]

Regardless of the species of Ehrlichia or the form of the disease, the choice of drugs to treat ehrlichiosis is tetracycline group of drugs.[15] High use of antibiotics can have negative aspects for animal health, human health, and the environment.[16] This rapid rise in usage of veterinary antibiotics necessitates the development of sustainable alternative; antibiotics are partly replaced by complementary or alternative medicine of which Homoeopathy is the most frequently applied.[17] Limited reports have been published in homoeopathic and alternative medicine journals on veterinary clinical trials with homoeopathic medicine/drugs where methodological weakness is noticed. Homoeopathic remedies have significant benefits since there are no residues in animal products nor does Homoeopathy generate resistant microorganisms. Homoeopathy aims to activate self-healing mechanisms of the body. In view of the above, the present study was carried out to detect E. canis by molecular technique and find out the therapeutic efficacy of a homoeopathic medicine Crotatus horridus against ehrlichiosis which was used against other tick-borne diseases such as babesiosis but not in ehrlichiosis.


  Materials and Methods Top


The study was conducted in the Department of Veterinary Medicine, College of Veterinary Sciences and Animal Husbandry, Selesih, Aizawl, in between August 2012 and July 2014. The study area lay between 25°6'N and 27°4'N latitude and 93°20'E to 95°15'E longitude.

Sample Size

Clinical cases of ehrlichiosis in dogs showing symptoms such as fever, diarrhoea, staggering gait, anaemia, debilitated condition, and presence of ticks were recorded during the study period. All-together, 67 dogs were initially suspected for ehrlichiosis. Confirmation of ehrlichiosis was based on the presence of E. canis in peripheral blood smear examination and PCR. 13 cases were confirmed by Polymerase chain reaction and out of these 8 also tested positive for E. canis in peripheral blood smear. For randomisation 12 cases were considered. One case with positive PCR and blood smear was excluded from the study for convenience of randomisation and treated in general OPD [Chart 1 [Additional file 1]].

Collection of Blood

About 5 ml blood samples were collected each ailing dog with or without anticoagulant for haemato-biochemical analysis. The blood collected with anticoagulant ethylene diamine tetra acetic acid was used for PCR and haematology, and blood without anticoagulant was used for serum separation. Collected serum samples were stored in deep freeze at −20°C until used for biochemical and enzymatic estimations. Similarly, a few samples were collected from healthy dogs for comparison. Giemsa-stained smears prepared from the blood were examined microscopically for the presence of E. canis morulae.

Molecular Detection of Ehrlichia canis

Fresh blood samples obtained from dogs were screened for the detection of E. canis DNA using PCR as per standard method.[18]

Extraction of genomic DNA from blood

DNA extraction was carried out using the DNA assay blood and tissue kit (Quiagen ® Kit, Catalog No 69504) as per manufacturer's protocol. In brief, about 100 µl anticoagulated blood taken individually from each of the samples in a 2 ml microcentrifuge tube was lysed in 20 µl proteinase K and the final volume adjusted to 220 µl by adding phosphate buffered saline before adding lysis buffer. The tubes were then incubated at 56°C in water bath for 10 min. Samples were then passed through silica gel based spin column and washed 2 times and then finally eluted with 100 µl elution buffer after following all the mid-step protocols, and the templates were kept at −20°C.

Polymerase chain reaction assay for detection of Ehrlichia canis

Target gene (16S rRNA) amplification was done using the nested PCR technique following the method of Murphy et al.[18] with modifications. The first PCR amplification aimed at amplifying a 477-bp region of the 16S rRNA gene of Ehrlichia species. Oligonucleotides ECC (5′AGAACGAACGCTGGCGGCAAGC3′) and ECB (5′CGTATTACCGCGGCTGCTGGCA3′) were used as sense and antisense primers, respectively for outer region. The nested PCR amplification aimed at amplifying 387-bp internal fragment specific to E. canis. Oligonucleotides ECA (5′CAATTATTTATAGC CTCTGGCTATAGGA 3′) and HE3 (5′ TATAGGTACCGTCATTATCTTCCCTAT 3′) were used as sense and antisense primers, respectively. Reaction mixture of 25 μl volume contains 2.5 μl of 10X PCR buffer, 0.5 μl of dNTP (10 mM each), forward and reverse primer 1 μl (10 pmol) each, Taq polymerase 0.2 μl (5 U/μl), template DNA 5 μl, and nuclease free water adjusted to 25 μl. A hot start PCR was used with initial denaturation of 94°C for 5 min and then 30 cycles of 94°C for 1 min, annealing at 65°C for 2 min, and extension at 72°C for 2 min. A final extension was kept at 72°C for 7 min for primary amplification. Nested PCR was performed where 2 μl of primary product was taken as template and annealing temperature was set at 55°C keeping other conditions as such. The PCR product was subjected to electrophoresis in an agarose gel (1.5%) prestained with ethidium bromide (0.5 µg/ml), and subsequent visualization was done in gel documentation system (alpha image system).

Evaluation of Therapeutic Potential of Homoeopathic Medicine Against Ehrlichiosis in Dogs

Twelve dogs positive for ehrlichiosis were divided randomly into two groups (n = 6) namely T1 and T2. Six apparently healthy dogs brought for regular check-up or vaccination were taken as control group (T3).

Dogs of T1 were treated with standard therapy with doxycycline at 20 mg/kg body weight orally for 20 days along with supportive therapy and T2 was treated with a Homoeopathy drug Crotalus horridus 200C (Hylands, USA) at 4 pills orally for 20 days. Therapeutic potency was evaluated by improvement of clinical signs, haemato-biochemical parameters, blood smear, and PCR assay for E. canis infection on days 0, 7, 14, and 21 posttreatment.

Clinical examination of dogs infected with ehrlichiosis before and after therapy

Each dog was subjected to detailed clinical examination as per standard procedure.[19] The presence of symptoms/signs/manifestations and involvement of different body system and systemic states were recorded on days 0, 7, 14, and 21 posttreatment.

Blood sample collection

To access the therapeutic efficacy, blood samples were collected on days 0, 7, 14, and 21 posttreatment by the same procedure as described elsewhere.

PCR was carried out as described elsewhere on days 0, 7, 14, and 21 blood samples to confirm the duration of presence of E. canis in blood and the efficacy of the drug in trial from the day of the starting of the treatment in different group.

Haemato-biochemical investigation

Haematological assays were performed within 2 h of blood collection by using an automated cell counter (Minos ST; Vet, Montpelier, France) calibrated for canine blood. The parameters measured were hematocrit, haemoglobin (Hb) concentration, total erythrocyte count, total leukocyte count (TLC), platelet count, and differential leukocytic count.

The total protein and albumin were estimated by the Biuret method [20] whereas globulin was estimated by calculation. The concentration of ALT was determined spectrophotometrically using the method of Reitman and Frankel.[21] The level of ALP in the serum was determined as described by Omotainse et al.,[22] using spectrophotometry method. Creatinine (alkaline picrate method), blood urea nitrogen (BUN) (Mod. Berthelot method), total bilirubin, and direct bilirubin (modified Jendrasik and Grof method) were also estimated by using spectrophotometry method.

Haemato-biochemical analyses were carried out on days 0, 7, 14, and 21 to know the efficacy of the therapy.

Therapeutic Evaluation

Therapeutic evaluation was done on the basis of improvement of clinical signs, blood haematology, and biochemical changes and negative results of PCR.

Statistical Analysis

Data were analyzed by using two-way ANOVA by Statistical Package SPSS 16 (SPSS, Science, Chicago, USA). Differences were considered statistically significant at P < 0.05 level.


  Results Top


During the study period, 67 dogs were suspected for ehrlichiosis, of which 8 cases were confirmed by blood smear (11.94%) whereas 13 cases were confirmed by PCR (19.40%).

Molecular Detection of Ehrlichia canis by Nested Polymerase Chain Reaction

Nested PCR was performed by using genus-specific external primer (477 bp) and species-specific nested internal primer (387 bp) to detect E. canis organism. Nested PCR positive samples were demonstrated which yielded an amplification of 387 bp fragment from 16S rRNA gene of E. canis [Figure 1]a and [Figure 1]b.
Figure 1: (a) Gel photo showing amplification of target gene of Ehrlichia canis. Lane 1–6: Positive for Ehrlichia canis; Lane M: 100bpDNA ladder; Lane N: Negative sample. (b) Gel picture of Ehrlichia canis nPCR product. M: 100bp DNA ladder; E: External product (477bp); I: Internal nested product (387bp)

Click here to view


Effect of Therapy on Clinical Signs and Physical Parameters

Physical parameters improved after 14 days in both the treatment groups [Table 1]. There was significant reduction (P < 0.05) of temperature, pulse, and respiration on day 7 posttherapy in both the groups. The clinical signs [Table 1]a] were also improved after treatment in both the groups. All the ailing animals showed alertness and improved appetite. PCR assay showed negative result in T2 group on day 21 posttherapy whereas no samples were detected positive by PCR assay in T1 group on day 14 posttherapy [Table 1]a. The critical analysis revealed that the Crotalus Horridus had almost equal intensity with doxycycline to manage the ehrlichiosis infection.
Table 1: Efficacy of doxycycline (T1) and Crotalus horridus (T2) on physical parameters of Ehrlichia-infected dog

Click here to view
Table 1a: Efficacy of doxycycline (T1) and Crotalus horridus (T2) on Ehrlichia-infected dogs on clinical improvement

Click here to view


Effect of Therapy on Haematological Profile

The haematological profiles of dogs (before and after therapy) are shown in [Table 2]. The Hb, packed cell volume, total erythrocyte count, TLC, and platelet count was significantly improved (P < 0.01) on day 21 in both T1 and T2 groups after therapy. The results clearly indicated that both doxycycline and Crotalus horridus 200C therapy improved the hematological values in ehrlichiosis-infected dogs.
Table 2: Evaluation of hematological values on clinical trial between doxycycline (T1) and Crotalus horridus (T2) on Ehrlichia-infected dogs

Click here to view


Changes in monocyte count are significantly (P < 0.01) reduced in T1 group of dogs receiving doxycycline as a standard therapy. However, significant changes were also found in T2 group of dogs receiving Crotalus horridus 200C as experimental therapy in a lesser intensity. Neutrophils, lymphocytes, and eosinophil counts were also found improved after 21 days therapy in both the groups of dogs.

Effect of Therapy on Serum-biochemical Profile

Mean ± standard error of serum biochemical profiles of dogs (before and after therapy) has been shown in [Table 3]. Total protein concentration of T1 and T2 was significantly decreased (P < 0.05) on day 0 as compared to healthy dogs (T3). However, protein values were increased in both the treated groups after therapy. Albumin level was significantly (P < 0.05) increased in T1 and T2 from day 0 (1.43 ± 0.35 g/dl and 1.17 ± 0.19 g/dl) to day 21 (3.78 ± 0.19 g/dl and 3.09 ± 0.28 g/dl) and there was no significant difference in globulin level in both the T1 and T2 before and after therapy. The levels of creatinine and BUN did not differ significantly from healthy group and nonsignificant decrease in both the parameters by the end of therapy depicted the therapeutic efficacy.
Table 3: Evaluation of serum biochemical parameters on clinical trial between doxycycline (T1) and Crotalus horridus (T2) on Ehrlichia-infected dogs

Click here to view


There was significant increase (P < 0.05) in the value of ALT and ALP on day 0 of both the treated groups (T1 and T2) as compared to healthy group (T3). There was significant (P < 0.05) decrease in the values of ALT and ALP on day 21 in both the treated groups. Dogs of both groups are depicting steady improvement in the ALT and ALP values as compared to healthy one. Direct bilirubin and total bilirubin also reveal steady nonsignificant improvement on both the groups of dogs. Critical analysis of the result on liver enzyme profile revealed steady improvement on the standard and experimental therapy.


  Discussion Top


In the present investigation, of 67 suspected dogs for canine ehrlichiosis, 13 (19.40%) were found positive by PCR. In the past, various studies have been carried out regarding the molecular prevalence of E. canis worldwide and the prevalence rate has been reported ranging from 3.1% to 88.0%.[23] As regards to the Indian scenario, the prevalence of E. canis varied from 19% to 59%.[24],[25],[26],[27] The variation in the prevalence reported by various workers may be attributed to sample size, geographical area, and climatic conditions which directly influence the tick population and time of sample collection.

The 16S rRNA gene fragment that was amplified in this study was also explored by Iqbal et al.,[28] McBride et al.,[29] Inokuma et al.,[30] and Unver et al.[6] with reasonably reliable results. To date, the epidemiological studies of canine ehrlichiosis in India have been based on blood smear results, as well as on serological evidence of circulating antibodies. The enhanced sensitivity of nested PCR for the detection of canine ehrlichiosis was earlier reported by Warner and Dawson [31] and Egenvall et al.[32] Many authors already described the superior sensitivity and specificity of PCR in diagnosing ehrlichiosis when compared to serology.[28],[33] In the present study, dogs were found to be positive for E. canis by nested PCR after 7 days of doxycycline as well as Crotalus horridus treatment, indicating the persistence of infection. It may also be an indicator of the short duration of treatment, especially in immune-compromised dogs. Hence, it is a highly effective tool for assessing the clearance of organisms after therapy.

Oral doxycycline has long been the drug of choice for treatment of CME. Failure to clear infections from hosts that respond to treatments for ehrlichial diseases can result in asymptomatic carriers that remain sources of infection for vectors and naive vertebrate hosts, so an alternative treatment regimen should be evaluated. Moreover, prolonged use of antibiotic therapy is associated with greater risk and likelihood of developing drug resistance. This phenomenon is a huge global concern and is mostly the result of history of indiscriminate overuse of these agents in both medicine and agriculture. The issue of resistance, with the subsequent development of recurrent infections, chronic infections, and the proliferation of progressively stronger strains of microorganisms has been the focus of extensive investigation and concern. There is definite evidence that this agent actually delays the development of host immunity while promoting a state of perpetual illness due to multiple factors associated with their use.[34] Homoeopathy has been used in animals to treat a multitude of conditions.[35] Our findings regarding clinical recovery of the dogs from ehrlichiosis with Crotalus horridus is encouraging. On the clinical score, Crotalus horridus and doxycycline showed progressive and significant regression in clinical signs on days 7, 14, and 21 posttherapy and improvement of haemato-biochemical values of infected dogs and there was no significant difference between the groups. Similarly, there was progressive decline in the parasitized erythrocytes in both the groups. However, reduction in parasitized erythrocytes in case of Crotalus horridus was evident only on day 21, but parasitized erythrocytes reduced significantly from the 7th day onward in case of doxycycline. The effectiveness of Crotalus horridus has been described in babesiosis of cattle and dog,[35],[36] on fever, hemorrhagic diathesis, yellow color of conjunctiva, jaundice, purpura hemorrhagica, profound anaemia;[37] however, it has never been evaluated in canine ehrlichiosis. The results showed an encouraging response of Crotalus horridus in the management of canine ehrlichiosis. The clinical efficacy of the homoeopathic drug was comparable with modern allopathic drug doxycycline. Moreover, the use of homoeopathic drugs in the management of ehrlichiosis in dogs has not previously been reported.

Our findings regarding clinical recovery of the dogs with ehrlichiosis with Crotalus horridus are encouraging. There was a significant reduction (P < 0.05) of temperature, pulse, and respiration on the 7th-day posttherapy. The clinical signs were also improved after treatment. All the ailing animals showed alertness and improved appetite. Haemato-biochemical changes due to ehrlichiosis-infected dogs returned to normalcy after Crotalus horridus treatment. From the present study, it seems that Crotalus horridus can be an effective and alternative in case of ehrlichiosis.

Acknowledgment

Authors were thankful to Dean, College of Veterinary Sciences and Animal Husbandry, Central Agricultural University, Selesih, Aizawl, Mizoram, India, for providing all the necessary facilities to do this research work.

Financial Support and Sponsorship

This article is a part of M.V. Sc thesis and for this research, financial support was got from Dean, College of Veterinary Sciences and Animal Husbandry, Central Agricultural University, Selesih, Aizawl, Mizoram, India.

Conflicts of Interest

There are no conflicts of interest.

 
  References Top

1.
Frank JR, Breitschwerdt EB. A retrospective study of ehrlichiosis in 62 dogs from North Carolina and Virginia. J Vet Intern Med 1999;13:194-201.  Back to cited text no. 1
    
2.
Stiles J. Canine rickettsial infections. Vet Clin North Am Small Anim Pract 2000;30:1135-49.  Back to cited text no. 2
    
3.
Ewing SA. Geographic distribution and tick transmission of Ehrlichia canis. J Med Entomol 1972;9:597-8.  Back to cited text no. 3
    
4.
Baneth G, Waner T, Koplah A, Weinstein S, Keysary A. Survey of Ehrlichia canis antibodies among dogs in Israel. Vet Rec 1996;138:257-9.  Back to cited text no. 4
    
5.
Hua P, Yuhai M, Shide T, Yang S, Bohai W, Xiangrui C. Canine ehrlichiosis caused simultaneously by Ehrlichia canis and Ehrlichia platys. Microbiol Immunol 2000;44:737-9.  Back to cited text no. 5
    
6.
Unver A, Perez M, Orellana N, Huang H, Rikihisa Y. Molecular and antigenic comparison of Ehrlichia canis isolates from dogs, ticks, and a human in Venezuela. J Clin Microbiol 2001;39:2788-93.  Back to cited text no. 6
    
7.
Singla LD, Singh H, Kaur P, Singh ND, Singh NK, Juyal PD. Serodetection of Ehrlichia canisinfection in dogs from Ludhiana district of Punjab, India. J Parasit Dis 2011;35:195-8.  Back to cited text no. 7
    
8.
Sarma K. Studies on Hepatopathies Due to Tick Born Intracellular Diseases in Dog to Evolve Integrated Therapeutic Approach. PhD Thesis, Submitted to Indian Veterinary Research Institute, Izatnagar, Bareilly, UP; 2012.  Back to cited text no. 8
    
9.
Harrus S, Waner T, Bark T. Canine monocytic ehrlichiosis – An update. Compend Contin Educ Pract Vet 1997;19:431-44.  Back to cited text no. 9
    
10.
Egenvall A, Bjöersdorff A, Lilliehöök I, Olsson Engvall E, Karlstam E, Artursson K, et al. Early manifestations of granulocytic ehrlichiosis in dogs inoculated experimentally with a Swedish Ehrlichia species isolate. Vet Rec 1998;143:412-7.  Back to cited text no. 10
    
11.
Greene CE, Harvey JW. Canine ehrlichiosis. In: Greene CE, editor. Clinical Microbiology and Infectious Diseases of the Dog and Cat. Philadelphia: Saunders WB Co.; 1990.  Back to cited text no. 11
    
12.
Platt-Samoraj A, Szweda W, Ciecierski H. Ehrlichiosis in the latest research. Med Weter 1998;54:363-7.  Back to cited text no. 12
    
13.
Pusterla N, Leutenegger CM, Sigrist B, Chae JS, Lutz H, Madigan JE. Detection and quantitation of Ehrlichia risticii genomic DNA in infected horses and snails by real-time PCR. Vet Parasitol 2000;90:129-35.  Back to cited text no. 13
    
14.
Peleg O, Baneth G, Eyal O, Inbar J, Harrus S. Multiplex real-time qPCR for the detection of Ehrlichia canis and Babesia canis vogeli. Vet Parasitol 2010;173:292-9.  Back to cited text no. 14
    
15.
Sainz A, Tesouro MA, Amusategui I, Rodríguez F, Mazzucchelli F, Rodríguez M. Prospective comparative study of 3 treatment protocols using doxycycline or imidocarb dipropionate in dogs with naturally occurring ehrlichiosis. J Vet Intern Med 2000;14:134-9.  Back to cited text no. 15
    
16.
Sarmah AK, Meyer MT, Boxall AB. A global perspective on the use, sales, exposure pathways, occurrence, fate and effects of veterinary antibiotics (VAs) in the environment. Chemosphere 2006;65:725-59.  Back to cited text no. 16
    
17.
Viksveen P. Antibiotics and the development of resistant microorganisms. Can homeopathy be an alternative? Homeopathy 2003;92:99-107.  Back to cited text no. 17
    
18.
Murphy GL, Ewing SA, Whitworth LC, Fox JC, Kocan AA. A molecular and serologic survey of Ehrlichia canis, E. chaffeensis, and E. Ewingii in dogs and ticks from Oklahoma. Vet Parasitol 1998;79:325-39.  Back to cited text no. 18
    
19.
Jones M. Clinical reasoning process in manipulative therapy. In: Boyling J, Palastanga N, editors. Grieve's Modern Manual Therapy. 2nd ed. Edinburgh: Churchill Livingstone; 1994. p. 577.  Back to cited text no. 19
    
20.
Reinhold JG. Manual determination of serum total protein albumin and globulin fractions by buiret method. In: Reiner M. editor. Standard Method of Clinical Chemistry. New York: Academic Press; 1953. p. 88.  Back to cited text no. 20
    
21.
Reitman S, Frankel S. A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am J Clin Pathol 1957;28:56-63.  Back to cited text no. 21
[PUBMED]    
22.
Omotainse SO, Anosa VO, Falaye C. Clinical and biochemical changes in experimental Trypanosoma brucei infection in dogs. Isr J Vet Med 1994;49:36-9.  Back to cited text no. 22
    
23.
da Silva GC, Benitez Ado N, Girotto A, Taroda A, Vidotto MC, Garcia JL, et al. Occurrence of Ehrlichia canis and Anaplasma platys in household dogs from northern Parana. Rev Bras Parasitol Vet 2012;21:379-85.  Back to cited text no. 23
    
24.
Lakshmanan B, John L, Gornathinayagam S, Dhinakarraj G. Molecular detection of Ehrlichia canis from blood of naturally infected dogs in India. Vet Arch 2007;77:307-12.  Back to cited text no. 24
    
25.
Abd Rani PA, Irwin PJ, Coleman GT, Gatne M, Traub RJ. A survey of canine tick-borne diseases in India. Parasit Vectors 2011;4:141.  Back to cited text no. 25
    
26.
Wise AE, Tarlinton RE. Seroprevalence of vectorborne diseases in free-roaming dogs in Goa, India. Vet Rec 2012;170:76.  Back to cited text no. 26
    
27.
Borthakur SK, Deka DK, Bhattacharjee K, Sarmah PC. Seroprevalence of canine dirofilariosis, granulocytic anaplasmosis and lyme borreliosis of public health importance in dogs from India's North East. Vet World 2014;7:665-7.  Back to cited text no. 27
    
28.
Iqbal Z, Chaichanasiriwithaya W, Rikihisa Y. Comparison of PCR with other tests for early diagnosis of canine ehrlichiosis. J Clin Microbiol 1994;32:1658-62.  Back to cited text no. 28
    
29.
McBride JW, Corstvet RE, Gaunt SD, Chinsangaram J, Akita GY, Osburn BI. PCR detection of acuteEhrlichia canis infection in dogs. J Vet Diagn Invest 1996;8:441-7.  Back to cited text no. 29
    
30.
Inokuma H, Raoult D, Brouqui P. Detection of Ehrlichia platys DNA in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island, Japan. J Clin Microbiol 2000;38:4219-21.  Back to cited text no. 30
    
31.
Warner CK, Dawson JE. Genus and species-level identification of Ehrlichia species by PCR and sequencing. In: Pershey DH, editor. PCR Protocols for Emerging Infectious diseases. Washington, DC: ASM Press; 1996, p. 100-11.  Back to cited text no. 31
    
32.
Egenvall A, Lilliehöök I, Bjöersdorff A, Engvall EO, Karlstam E, Artursson K, et al. Detection of granulocytic Ehrlichia species DNA by PCR in persistently infected dogs. Vet Rec 2000;146:186-90.  Back to cited text no. 32
    
33.
Wen B, Rikihisa Y, Mott JM, Greene R, Kim HY, Zhi N, et al. Comparison of nested PCR with immunofluorescent-antibody assay for detection of Ehrlichia canis infection in dogs treated with doxycycline. J Clin Microbiol 1997;35:1852-5.  Back to cited text no. 33
    
34.
Kilkkinen A, Rissanen H, Klaukka T, Pukkala E, Heliövaara M, Huovinen P, et al. Antibiotic use predicts an increased risk of cancer. Int J Cancer 2008;123:2152-5.  Back to cited text no. 34
    
35.
Macleod G. The Treatment of Cattle by Homeopathy. Saffron Walden, England: The C. W. Daniel Company Ltd.; 1981.  Back to cited text no. 35
    
36.
Chaudhuri S, Varshney JP. Clinical management of babesiosis in dogs with homeopathic Crotalus horridus 200C. Homeopathy 2007;96:90-4.  Back to cited text no. 36
    
37.
Murphy R. Lotus Materia Medica 2nd revised Edition.. New Delhi: B. Jain Publishers Pvt. Ltd.; 2002.  Back to cited text no. 37
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
   Abstract
  Introduction
   Materials and Me...
  Results
  Discussion
   References
   Article Figures
   Article Tables

 Article Access Statistics
    Viewed5999    
    Printed24    
    Emailed0    
    PDF Downloaded376    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]